View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14094_low_3 (Length: 431)
Name: NF14094_low_3
Description: NF14094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14094_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 2e-59; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 295 - 423
Target Start/End: Original strand, 28407168 - 28407296
Alignment:
| Q |
295 |
ttttacctaatacctcatatttatttatggagataatcataaaagtggaaaatgatataccaattgatatacctagttgtgtagaaatcttgattctttt |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28407168 |
ttttacctaatacctcatatttatttatggagataatcatacaagtggaaaatgatataccaattgatatacctagttgtgtaaaaatcttgattctttt |
28407267 |
T |
 |
| Q |
395 |
ccaaatatgtatattgcttatagaataat |
423 |
Q |
| |
|
||||||||||||||||||||| ||||||| |
|
|
| T |
28407268 |
ccaaatatgtatattgcttatggaataat |
28407296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 28406691 - 28406781
Alignment:
| Q |
19 |
ggttaacacagtatatacacacatattgataagatatcaaaatttctcactcataaaattattaaaatttatatttataaaatgtttcgtg |
109 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28406691 |
ggttaacacagtatacacacgcatattgataagatatcaaaatttctcactcataaaattattaaaatttatatttataaaatgattcgtg |
28406781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 200 - 273
Target Start/End: Original strand, 28406868 - 28406941
Alignment:
| Q |
200 |
gttgcatcataaaccctaaaaaaggggagcagccttaaaataaaagaaaaagggagcaacaacaatgcaaccct |
273 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28406868 |
gttgcatcataaactctaaaaaaggggagcagccttaaaataaaagaaaaagggagcaacaacaatgcaaccct |
28406941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University