View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14095_low_6 (Length: 434)
Name: NF14095_low_6
Description: NF14095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14095_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 69; Significance: 8e-31; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 340 - 420
Target Start/End: Original strand, 10210039 - 10210119
Alignment:
| Q |
340 |
atgttggtaaaggagcacgtgctgctcgattacagagaaataaaatggtattgttatatctttatatgttccttgtctgtg |
420 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
10210039 |
atgttggtaaaggtgcacgtgctgctcgattacagagaaataaaatggtactgttatatctttatatgttccttgtttgtg |
10210119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University