View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14096_high_14 (Length: 270)
Name: NF14096_high_14
Description: NF14096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14096_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 19 - 182
Target Start/End: Complemental strand, 45640525 - 45640354
Alignment:
| Q |
19 |
acagatacatatgtatgccagttatcttgtacagcaaacctcctaaaaatgtctggcaatatcaatgacagcttttgttttgattttgagagttaggatg |
118 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
45640525 |
acagacacatatgtaagccagttatcttgtacagcaaacctcctaaaaatgtctggctatatcaatgacagtttttgttttgattttgggagttaggatg |
45640426 |
T |
 |
| Q |
119 |
caagtgtccctcagt--------ttttcatatatgataagcattttgatgtagaaacaaaagctttatacta |
182 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45640425 |
caagtgtccctcagtttttaagtttttaatatatgataagcattttgatgtagaaacaaaagctttatacta |
45640354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 102 - 189
Target Start/End: Complemental strand, 45646575 - 45646487
Alignment:
| Q |
102 |
ttttgagagttaggatgcaagtgtccctcagtttttcatatatgataagcattttgatgt-agaaacaaaagctttatactacgtatca |
189 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||| ||||||||||||||| | |||| | ||||||| ||||||||||| |||||| |
|
|
| T |
45646575 |
ttttgagagttgggatgcaattgtccctcagtttttaatatatgataagcatgtctatgtaataaacaaaggctttatactatgtatca |
45646487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University