View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14096_high_17 (Length: 233)
Name: NF14096_high_17
Description: NF14096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14096_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 4844803 - 4844596
Alignment:
| Q |
18 |
atttgcaatagatgatttccaatggatttggagcgttattgaacctgagctgatttctcttcgaactttgtgtcatgcatatcggtgacgagtgctatac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4844803 |
atttgcaatagatgatttccaatggatttggagcgttattgaacctgagctgatttctcttcgaactttgtgtcatgcatatcggtgacgagtgctatac |
4844704 |
T |
 |
| Q |
118 |
cttgtgtcatgcatcaactttgtgccagacccttgcttagctcaagctttggttcaagcaaatg-----aaatcaaggttacctaaattcatgaagtttc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4844703 |
cttgtgtcatgcatcaactttgtgccagacccttgcttagctcaagctttggttcaagcaaatgaaatgaaatcaaggttacctaaattcatgaagtttc |
4844604 |
T |
 |
| Q |
213 |
agtataat |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
4844603 |
agtataat |
4844596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 70 - 203
Target Start/End: Complemental strand, 4709983 - 4709851
Alignment:
| Q |
70 |
atttctcttcgaactttgtgtcatgcatatcggtgacgagtgctataccttgtgtcatgcatcaactttgtgccagacccttgcttagctcaagctttgg |
169 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || || |||||||||||||| ||||| | |
|
|
| T |
4709983 |
atttctctttgaactttgtgtcatgcatatcggtgactggtgctataccttgtgtcatgcatcaactttatggaag-gccttgcttagctcatgctttag |
4709885 |
T |
 |
| Q |
170 |
ttcaagcaaatgaaatcaaggttacctaaattca |
203 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| |
|
|
| T |
4709884 |
ttcaagcaaatgaaatcaaagttatctaaattca |
4709851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 141
Target Start/End: Original strand, 40409777 - 40409809
Alignment:
| Q |
109 |
gtgctataccttgtgtcatgcatcaactttgtg |
141 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
40409777 |
gtgctgtaccttgtgtcatgcatcaactttgtg |
40409809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University