View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14097_high_26 (Length: 308)
Name: NF14097_high_26
Description: NF14097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14097_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 81 - 218
Target Start/End: Complemental strand, 52593420 - 52593283
Alignment:
| Q |
81 |
aatcatgaggcagtagtatgtctctctttattttgtcctttttaaaaaagtctgtgatcatgaaatgattatgatggggtagtagtatattatttgtgcg |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52593420 |
aatcatgaggcagtagtatgtctctctttattttgtcctttttaaaaaagtctgtgatcatgaaatgattatgatggggtagtagtatattgtttgtgcg |
52593321 |
T |
|
| Q |
181 |
tgatagaaggtaatctctttgtaataataatacatgag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52593320 |
tgatagaaggtaatctctttgtaataataatacatgag |
52593283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 241 - 291
Target Start/End: Complemental strand, 52593263 - 52593212
Alignment:
| Q |
241 |
agatttgaa-tttcatgactagtaaaaagttgaatgttgccaaggttactat |
291 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52593263 |
agatttgaaatttcatgactagtaaaaagttgaatgttgccaaggttactat |
52593212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University