View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14097_high_32 (Length: 247)
Name: NF14097_high_32
Description: NF14097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14097_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 41282898 - 41283126
Alignment:
| Q |
1 |
acggaagatcatcaacatcggtgtttggatccactgttgtagtttgtatgagaaacttatctctaaattgcatgccaggaggatattctcgttgggcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41282898 |
acggaagatcatcaacatcggtgtttggatccactgttgtagtttgtatgagaaacttatctctaaattgcatgccaggaggatattctcgttgggcttg |
41282997 |
T |
|
| Q |
101 |
gagggtgactgtgaatnnnnnnnnnnntgaagaatatgatagatgctaatactacacaatggtagaagctcaaagatcacaaacaagcagatagtacata |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41282998 |
gagggtgactgtgaat-aaaaaaaaaatgaagaatatgatagatgctaatactgcacaatggtagaagctcaaagatcacaaacaagcagatagtacata |
41283096 |
T |
|
| Q |
201 |
tgtctggtttgcaacttagtattacatttt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41283097 |
tgtctggtttgcaacttagtattacatttt |
41283126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 2 - 112
Target Start/End: Complemental strand, 4207496 - 4207386
Alignment:
| Q |
2 |
cggaagatcatcaacatcggtgtttggatccactgttgtagtttgtatgagaaacttatctctaaattgcatgccaggaggatattctcgttgggcttgg |
101 |
Q |
| |
|
|||||||||||||||||| || |||||| ||||| | ||| | |||| ||||||||| ||| || ||||||| | ||||| ||||| ||||||||||| |
|
|
| T |
4207496 |
cggaagatcatcaacatcagtatttggacccactatcgtactctgtaagagaaacttgtctttacattgcatatctggagggtattcgcgttgggcttga |
4207397 |
T |
|
| Q |
102 |
agggtgactgt |
112 |
Q |
| |
|
||||||||||| |
|
|
| T |
4207396 |
agggtgactgt |
4207386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University