View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14097_high_36 (Length: 231)
Name: NF14097_high_36
Description: NF14097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14097_high_36 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 42810771 - 42810541
Alignment:
| Q |
1 |
ggttttgatgtagtcacaaattctacgctttcactcaatcaatacagcggtgccatttatgagaaagtggctaacttttagtgtagataaaaaatttatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42810771 |
ggttttgatgtagtcacaaattctacgctttcactcaatcaatacagcggtgccatttatgagaaagtggctaacttttagtgtagataaaaaatttatg |
42810672 |
T |
 |
| Q |
101 |
tgaggaatgaaatagcaaactattgcgctacattaatttatatcgtgtgttttacttttaaatatacataatagctgnnnnnnngttgttctttatcctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
42810671 |
tgaggaatgaaatagcaaactattgcgctacattaatttatattgtgtgttttacttttaaatatacataatagttgtttttttgttgttctttatcctg |
42810572 |
T |
 |
| Q |
201 |
taatccccacagacatagctttggattaatc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42810571 |
taatccccacagacatagctttggattaatc |
42810541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University