View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14097_low_31 (Length: 252)
Name: NF14097_low_31
Description: NF14097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14097_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 40370540 - 40370306
Alignment:
| Q |
1 |
ataactcttctgaattaattctaatttttcatttaaacttcctaataactgccaatacataattctggaaacttaaatgaaataaaaattaattctaact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40370540 |
ataactcttctgaattaattctaatttttcatttaaatttcctaataactgccaatacataattctggaaacttaactgaaataaaaattaattctaact |
40370441 |
T |
 |
| Q |
101 |
taactgtcagttattgaacagttaagttggaaaataacttatgcagtat-aatattcagtattttggaagagaatagtttctactctctaagacatcaag |
199 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40370440 |
taactgtcagttattcaacagttaagttggaaaataacttatgcagtataaatattcagtattttggaagagaatagtttctactctctaagacatcaag |
40370341 |
T |
 |
| Q |
200 |
tgtgtggggttgttattttggttgtaggcaaaatc |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
40370340 |
tgtgtggggttgttattttggtcgtaggcaaaatc |
40370306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University