View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14097_low_37 (Length: 239)
Name: NF14097_low_37
Description: NF14097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14097_low_37 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 52624786 - 52625003
Alignment:
| Q |
19 |
ctccagtgtctcagcatccaaagctgatctcagaaatgccaccaggtaaaacacctcctcgtctggtgtcatcgccgagctccgatggtcccacctaaca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52624786 |
ctccagtgtctcagcatccaaagctgatctcagaaatgccaccaggtaaaacacctcctcgtctggtgtcaccgccgagctccgatggtcccacctaaca |
52624885 |
T |
 |
| Q |
119 |
ccaaaatctcattacaatccatcatcactaaaatcatgttttggatttttcttttcatacaatcaatgatgcaaaacggtataagacagtagctacgttg |
218 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52624886 |
ccaaaatctcattacaatc---catcactaaaatcatgttttggatttttcttttcatacaatcaatgatgcaaaacggtataagacagtagctacgttg |
52624982 |
T |
 |
| Q |
219 |
ttagcaatggtttgacttgtc |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
52624983 |
ttagcaatggtttgacttgtc |
52625003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University