View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14097_low_40 (Length: 223)
Name: NF14097_low_40
Description: NF14097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14097_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 30418259 - 30418472
Alignment:
| Q |
1 |
gaattgaaaccaatagctgtgatgatgacacaaagtgtgtgatggcacgagatgaatgtccgtttgaataaaacattgatccaagtcactctcagcacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30418259 |
gaattgaaaccaatagctgtgatgatgacacagagagtgtgatggcacgagatgaatgtccgtttgaataaaaaattgatccaagtcactctcagcacac |
30418358 |
T |
 |
| Q |
101 |
aattagnnnnnnnnactaccttcagtatgattgtgacgcctcatttcttatggataacttgaaaagagactgatcaattgatcacttgtcccacatgtat |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30418359 |
aattagttttttttactaccttcagtatgattgtgacgcctcatttcttatggataacttgaaaagagactgatcaattgatcacttgtcccacatgtat |
30418458 |
T |
 |
| Q |
201 |
ataaaaatagtata |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30418459 |
ataaaaatagtata |
30418472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University