View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14097_low_42 (Length: 202)
Name: NF14097_low_42
Description: NF14097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14097_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 34 - 183
Target Start/End: Complemental strand, 42526196 - 42526053
Alignment:
| Q |
34 |
attgtctattcacatagcaaatgggtgaagaagtaaaacaggtgagcctaattaattttttggcattctactttctttttcttatagatgtagtgcagac |
133 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42526196 |
attgtctgttcacatagcaaatgggtgaag---taaaacaggtgagcct---taattttttggcattctactttctttttcttatagatgtagtgcagac |
42526103 |
T |
 |
| Q |
134 |
tagtttttatgattcttcttttttgaattggataggaaccacctaaggaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42526102 |
tagtttttatgattcttcttttttgaattggataggaaccacctaaggaa |
42526053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University