View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14098_high_16 (Length: 311)
Name: NF14098_high_16
Description: NF14098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14098_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 296
Target Start/End: Complemental strand, 4934909 - 4934627
Alignment:
| Q |
14 |
gaataataataggtctttgatcaatcataatttgttaacaaggaccaaggatggtaactggtatccaaaaattgagcttaaagggatatactatattttg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
4934909 |
gaataataataggtctttgatcaatcataatttgttaacaaggaccaaggatggtaattggtatccaaaaattgagtttaaaggcatatactatattttg |
4934810 |
T |
 |
| Q |
114 |
acgcataaaagtcgtttaccgtatataatacattagaactagtgnnnnnnnnatctgagttgg-ataaaacgatgataaagaaagaaaatagtaatttta |
212 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4934809 |
acgcataaaagtcttttgccgtatataatacattataactagtgttttttt-atctgagttgggataaaacgatgataaagaaaaaaaatagtaatttta |
4934711 |
T |
 |
| Q |
213 |
cctaattcttcttcttaagcaataaggtgtcattcaaactgagccacatatagttttaatatttgaatgttttattttattttt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4934710 |
cctaattcttcttcttaagcaataaggtgtcattcaaactgagccacatatagttttaatatttgaatgttttattttattttt |
4934627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University