View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14098_low_10 (Length: 407)
Name: NF14098_low_10
Description: NF14098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14098_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-122
Query Start/End: Original strand, 69 - 399
Target Start/End: Original strand, 27508108 - 27508438
Alignment:
| Q |
69 |
agaatgtcaaaagaatcacgccgtcagcataggcggtcatgccgtggatggatgttgcgagtttttagctgccggagaggaaggaacactggaagcggtg |
168 |
Q |
| |
|
||||||||| |||||||||||||| ||| | || || || || || || || |||||||||||| | |||||||| || ||||||||||| ||||| || |
|
|
| T |
27508108 |
agaatgtcagaagaatcacgccgttagcttcggtggccacgctgttgacggttgttgcgagtttattgctgccggtgaagaaggaacacttgaagctgtt |
27508207 |
T |
 |
| Q |
169 |
atttgtgctgcttgtggctgtcaccggaacttccaccgcaaagagatcgatggtgaaacggttagttcatgtacccggccacagccaccccctccaccgc |
268 |
Q |
| |
|
||||| || |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
27508208 |
atttgcgccgcttgtaactgtcaccggaacttccaccgcaaagagatcgatggtgaaacggttagttcatgtaaccggccacagccaccacctccaccgc |
27508307 |
T |
 |
| Q |
269 |
cgcaataccatcaccacagcaatcaattctcgccttactaccaccgcgctcctccttccacagccggttaccttcaccaccatcatcttgcaactccggt |
368 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27508308 |
cgcaataccatcaccacaacaatcaattctcgccttactaccaccgtgctcctccttccacagccggttaccttcaccaccatcatcttgcaactccggt |
27508407 |
T |
 |
| Q |
369 |
ggcacatcacagaccgttggctctctctgct |
399 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
27508408 |
ggcacatcacagaccgttggctctccctgct |
27508438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 225
Target Start/End: Complemental strand, 46301295 - 46301074
Alignment:
| Q |
4 |
ggaggagcagagactggcacaggcggtggtgtcaaaagtgggccagcaggaacggtcagatacaaagaatgtcaaaagaatcacgccgtcagcataggcg |
103 |
Q |
| |
|
|||||||||| ||| | |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46301295 |
ggaggagcagcgaccgccacaggcggtggtgtcaaaagtgggctagcaggaacggtcagatacaaagaatgtcaaaagaatcacgccgtcagcataggcg |
46301196 |
T |
 |
| Q |
104 |
gtcatgccgtggatggatgttgcgagtttttagctgccggagaggaaggaacactggaagcggtgatttgtgctgcttgtggctgtcaccggaacttcca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46301195 |
gtcatgccgtggatggatgttgcgagtttttagctgccggagaggaaggaacactggaagcggtgatttgtgctgcttgtggctgtcaccggaacttcca |
46301096 |
T |
 |
| Q |
204 |
ccgcaaagagatcgatggtgaa |
225 |
Q |
| |
|
||||||||| ||||| |||||| |
|
|
| T |
46301095 |
ccgcaaagaaatcgacggtgaa |
46301074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 160 - 225
Target Start/End: Complemental strand, 35192931 - 35192866
Alignment:
| Q |
160 |
gaagcggtgatttgtgctgcttgtggctgtcaccggaacttccaccgcaaagagatcgatggtgaa |
225 |
Q |
| |
|
||||| || ||||| || |||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35192931 |
gaagctgttatttgcgccgcttgtaactgtcaccagaacttccaccgcaaagagatcgatggtgaa |
35192866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 160 - 225
Target Start/End: Complemental strand, 44747992 - 44747927
Alignment:
| Q |
160 |
gaagcggtgatttgtgctgcttgtggctgtcaccggaacttccaccgcaaagagatcgatggtgaa |
225 |
Q |
| |
|
||||| || ||||| || |||||| |||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
44747992 |
gaagctgttatttgcgccgcttgtaactgtcaccagaacttccactgcaaagagatcgatggtgaa |
44747927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 69 - 163
Target Start/End: Original strand, 26145996 - 26146090
Alignment:
| Q |
69 |
agaatgtcaaaagaatcacgccgtcagcataggcggtcatgccgtggatggatgttgcgagtttttagctgccggagaggaaggaacactggaag |
163 |
Q |
| |
|
||||||||| |||||||||||||| ||| | || || || || || || || |||||||||||| | |||||||| || ||||||||||| |||| |
|
|
| T |
26145996 |
agaatgtcagaagaatcacgccgttagcttcggtggccacgctgttgacggttgttgcgagtttatcgctgccggtgaagaaggaacacttgaag |
26146090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 172 - 207
Target Start/End: Original strand, 24181178 - 24181213
Alignment:
| Q |
172 |
tgtgctgcttgtggctgtcaccggaacttccaccgc |
207 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24181178 |
tgtgctgcttgtggctgtcaccggaatttccaccgc |
24181213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University