View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14098_low_24 (Length: 230)

Name: NF14098_low_24
Description: NF14098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14098_low_24
NF14098_low_24
[»] chr3 (1 HSPs)
chr3 (22-210)||(53147239-53147427)


Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 22 - 210
Target Start/End: Complemental strand, 53147427 - 53147239
Alignment:
22 tcatggcacgtgacgtgattttactaacatcattcccttccaattttacaaacattggaattaattaatacaaaaataaccatgagattgaattgaatta 121  Q
    |||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
53147427 tcatggcacgtgacatgattttactaacatcattctcttccaattttacaaacattggaattaattaagacaaaaataaccatgagattgaattgaatta 53147328  T
122 ccatgtgcagaataaccaatgtagatccacgaaataaattgttgtttaatttttaaaacattaagctattacagtacttagtagtagta 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
53147327 ccatgtgcagaataaccaatgtagatccacgaaataaattgttgtttaatttttaaaacattaagctattacagtagttagtagtagta 53147239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University