View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14098_low_28 (Length: 207)
Name: NF14098_low_28
Description: NF14098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14098_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 15 - 157
Target Start/End: Complemental strand, 1793550 - 1793408
Alignment:
| Q |
15 |
attattctgtccaatttgtagtgaacaattatcatatcatatcatcatatcatagtttttatttggataccttctgctcaaacttttcgagcgtcaagtt |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1793550 |
attactctgtccaatttgtagtgaacaaatatcatatcatattatcatatcgtagttttcatttggataccttctgctcaaacttttcgagtgtcaagtt |
1793451 |
T |
|
| Q |
115 |
taatcacttgatcaaaagcttaaaaagggattaagggtatttt |
157 |
Q |
| |
|
||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
1793450 |
taatcacttgatcgaaagtttaaaaagggactaagggtatttt |
1793408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University