View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14099_high_4 (Length: 250)
Name: NF14099_high_4
Description: NF14099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14099_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 13 - 183
Target Start/End: Original strand, 4474850 - 4475021
Alignment:
| Q |
13 |
tgaagtggatgaaaatacatgaacatcttgagaaagggaaagatataaacca-aggtttgctttatctgatatcaacatttaaaaaagtacgtataaagg |
111 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4474850 |
tgaagtggatgaaattacatgaacatcttgagaaagggaaagatataaaccagaggtttgctttatctgatatcaacatttaaaaaagtacgtataaagg |
4474949 |
T |
 |
| Q |
112 |
taggtgagacataagtaggattgaatattcaagagagattgtttctgattaagtaagtacaattcagatctt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4474950 |
taggtgagacataagtaggattgaatattcaagacagattgtttctgattaagtaagtacaattcagatctt |
4475021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University