View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14099_low_3 (Length: 329)
Name: NF14099_low_3
Description: NF14099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14099_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 193 - 313
Target Start/End: Complemental strand, 12925874 - 12925754
Alignment:
| Q |
193 |
gatctcaaacaggagcgtgaattcttcatctgcttcgttttctgaagaatcggttgatttatcgctgatttctgagatcactgaagaaaatctcaacgaa |
292 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12925874 |
gatctcaaacaagagcgtgaattcttcatctgcttcgttttctgaagaatcggttgatttatcgctgatttctgagatcactgaagaaaatctcaacgaa |
12925775 |
T |
 |
| Q |
293 |
gatgtttcagtaagtgtaatt |
313 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
12925774 |
gatgtttcagtaagtgtaatt |
12925754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 12926059 - 12925954
Alignment:
| Q |
1 |
aactctctgcacctcgctccgcatagaatcgcaccgcaagatccaaaaactttccgtcgaagaaatccagaaaggcacgcacatccaccgattcctaaac |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12926059 |
aactctctgcacctcgctccgcagagaatcgcaccgcaagatccaatgactttccgtcgaagaaatccagaaaggcacgcacattcaccgattcctaaac |
12925960 |
T |
 |
| Q |
101 |
ttctca |
106 |
Q |
| |
|
|||||| |
|
|
| T |
12925959 |
ttctca |
12925954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University