View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1409_high_3 (Length: 403)
Name: NF1409_high_3
Description: NF1409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1409_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-131; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 28 - 277
Target Start/End: Original strand, 38557446 - 38557695
Alignment:
| Q |
28 |
atcagagttcaaattgatacagtatttgagattatgcttctacttgtagactataagttcaatagatgcttttttgtaacccatcaatattcattaatct |
127 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38557446 |
atcagagttcaaattaatacagtatttgagattatgcttctacttgtagactataagttcaatagatgcttttttgtaacccgtcaatattcattaatct |
38557545 |
T |
|
| Q |
128 |
gctcattgtctcttatcggatttataaaggttaatgatcaagccaggctttcacaaaatccctcgtccgagaagactcaaacagactcattgctttcttc |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38557546 |
gctcattgtctcttatcggatttataaaggttaatgatcaagccaggctttcacaaaatccctcgtccgaggagactcaaacagactcattgctttcttc |
38557645 |
T |
|
| Q |
228 |
ttgtttgtatgatggtgaaagaagtcttgggttatcaggcatcatctggg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38557646 |
ttgtttgtatgatggtgaaagaagtcttgggttatcaggcatcatctggg |
38557695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 339 - 374
Target Start/End: Original strand, 38557757 - 38557792
Alignment:
| Q |
339 |
actaatatattaccttgatgcagaatgactctatgg |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38557757 |
actaatatattaccttgatgcagaatgactctatgg |
38557792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University