View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14100_high_19 (Length: 248)
Name: NF14100_high_19
Description: NF14100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14100_high_19 |
 |  |
|
| [»] scaffold0197 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0197 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 6185 - 5957
Alignment:
| Q |
1 |
ggaaagtggcatagggttccactattggctggtaaaagttaatcaattatttttcctttttcttgatatttctatttgtcttctctaaaacggatattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6185 |
ggaaagtggcatagggttccactattggctggtaaaagttaatcaattatttttcctttttcttgatatttctatttgtcttctctaaaacggatattta |
6086 |
T |
 |
| Q |
101 |
attacttctttgaagtatgtcatctgaggttcgatctctcacaaatatgtatggaagaacannnnnnnattg-aaaatcaactgtcgacctcttaaaacg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |||||||||||||||||| |
|
|
| T |
6085 |
attacttctttgaagtatgtcatctgaggttcgatctctcacaaatatgtatggaagaacatttttttattgaaaaatcaattgtcgacctcttaaaacg |
5986 |
T |
 |
| Q |
200 |
gatc-cgttattttgagagattggtccat |
227 |
Q |
| |
|
|||| |||||||||||||||||||||| |
|
|
| T |
5985 |
gatcatattattttgagagattggtccat |
5957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0197; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 110 - 230
Target Start/End: Complemental strand, 5893 - 5773
Alignment:
| Q |
110 |
ttgaagtatgtcatctgaggttcgatctctcacaaatatgtatggaagaacannnnnnnattgaaaatcaactgtcgacctcttaaaacggatccgttat |
209 |
Q |
| |
|
||||||||||||||||||||||| |||||| | ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5893 |
ttgaagtatgtcatctgaggttccatctctgataaatatgtatggaagaacatttttttattgaaaatcaactgtcgacctcttaaaacggatccgttat |
5794 |
T |
 |
| Q |
210 |
tttgagagattggtccatact |
230 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5793 |
tttgagagattggtccatact |
5773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University