View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14100_low_18 (Length: 281)
Name: NF14100_low_18
Description: NF14100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14100_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 10 - 264
Target Start/End: Original strand, 37975674 - 37975928
Alignment:
| Q |
10 |
aatatctgtggtcatttcacatgatttgtttgctcatttatatatattaatctctctctgccatctcttattgtatattgtgccacctcacaaatctagc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37975674 |
aatatctgtggtcatttcacatgatttgtttgctcatttatatatattaatctctctctgccatctcttattgtatattgtgccacctcacaaatctagc |
37975773 |
T |
 |
| Q |
110 |
tacttaaacaaatcaggcataaggttcatataatagttagtggacacagaagaactatataactataatggaaatctcccaaacctttcttcctttttct |
209 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37975774 |
tacttaaacaaatcagacataagtttcatataatagttagtggacacagaagaactatataactacaatggaaatctcccaaacctttcttcctttttct |
37975873 |
T |
 |
| Q |
210 |
ttagagaaatctgaaaaatgaaacaccttttaaatacaagggacaggtataacct |
264 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37975874 |
ttagagaaatctgaaaaatgaaataccttttaaatacaagggacaggtataacct |
37975928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University