View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14100_low_20 (Length: 252)
Name: NF14100_low_20
Description: NF14100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14100_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 10 - 156
Target Start/End: Original strand, 28211846 - 28211992
Alignment:
| Q |
10 |
atcctgaggaattacgtagcatcacatacctgcccaacaagcatttgttaatctttcaaatatatttacaaattaattgtaaactataaactaatttcaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
28211846 |
atcctgaggaattacgtagcatcacatacctgcacaacaagcattagttaatctttcaaatatatttacaaattaattgcatactataaactaatttcaa |
28211945 |
T |
 |
| Q |
110 |
tcttgagaaacctatgtaatacttttaaaaaatattgtaaaagaaaa |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28211946 |
tcttgagaaacctatgtaatacttttaaaaaatattggaaaagaaaa |
28211992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 160 - 252
Target Start/End: Original strand, 28212028 - 28212120
Alignment:
| Q |
160 |
aacatatagtaccttttgtctatatttagaggtgacaactttccctttagagatggactccatgttcttttaaatgagatttcaacttgttct |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28212028 |
aacatatagtaccttttgtctatatttagaggtgacaactttccctttagagatggattccatgttcttttaaatgagatttcaacttgttct |
28212120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University