View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14100_low_7 (Length: 527)
Name: NF14100_low_7
Description: NF14100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14100_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 1 - 507
Target Start/End: Complemental strand, 17996363 - 17995864
Alignment:
| Q |
1 |
gaaggctttggcgtcaccgctactccggggaaatcgttcaaaaatgcgttgacgttggagaaggataattttccggttatgaatggggtttctccaacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||| ||||||||| |
|
|
| T |
17996363 |
gaaggctttggcgtcaccgctactccggggaaatcgttcaaaaatgcgttgacgttggaaaaggataattttccgattttgaatggggttgctccaacat |
17996264 |
T |
|
| Q |
101 |
tggaaattcttccatcggaggatatgctggactatttgcagtgggcctttataggggaactgttccatcataatgatgttttggaggtgcaacaagcttt |
200 |
Q |
| |
|
|||||||| |||||||| |||| ||||| ||||||||||||||| ||||||| ||||||||||||||||| || |||| ||||||||||||||||||||| |
|
|
| T |
17996263 |
tggaaattgttccatcgaaggagatgctagactatttgcagtggacctttatgggggaactgttccatcagaaggatgctttggaggtgcaacaagcttt |
17996164 |
T |
|
| Q |
201 |
ggttatggaaggcattcaaggtgttaaagtcacagagatgggagacagaaagatgctcctgcatattgaatgtatgaaggatattgatccagttcacaat |
300 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||||||||| || |||| |||| |
|
|
| T |
17996163 |
ggttatggaaggcattcgaggtgttaaagtcatagagatgggagacagaaagatgcttttgcatattgaaggtatgaaggatattgacccggttcgcaat |
17996064 |
T |
|
| Q |
301 |
agccatctagcttggtgttattcaatgttttcttcggttagaaggtggacacctcagttggtggcaaatagtagggcggtttggctccatgttcatggta |
400 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
17996063 |
agccatctagcttggtg-------atattttcttcggttagaaggtggacacctcagttggtggcagatagtatggcggtttggctccatgttcatggta |
17995971 |
T |
|
| Q |
401 |
ttcccctccatgtttgggatgaacccttgttcaagaagattggctctttgtttggggtattcttagattttgatgattacaccattgggagaaagaggat |
500 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| | |
|
|
| T |
17995970 |
ttcccctccatgtttgggatgaacccttgttcaagaagattgactctttgtttggggtgttcttagattttgatgattacacaattgggagaaagaggtt |
17995871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University