View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14102_high_9 (Length: 227)
Name: NF14102_high_9
Description: NF14102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14102_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 14 - 210
Target Start/End: Original strand, 703043 - 703238
Alignment:
| Q |
14 |
caaaggcaaatgcacaaggtactaaagctaagaaggctgtcacaaacaagattgaagtcttcatgnnnnnnnnggaacaattcaatttatgtattttgct |
113 |
Q |
| |
|
|||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
703043 |
caaaggcaaaggcacaagatgctaaagctaagaaggctgtcacaaacaagattgaagtcttcatgttttttt-ggaacaattcaatttatgtattttgct |
703141 |
T |
 |
| Q |
114 |
tgtatatggttggttatgcaaacatggtgtctttttataagcaagtgtgacattggaatagttttacttgcacaaagcctataaagaccaagtaaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
703142 |
tgtatatggttggttatgcaaacatggtgtctatttataagcaagtgtgacattggaatagttttacttgcacaaagcctataaagaccaagtaaat |
703238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 14 - 210
Target Start/End: Complemental strand, 712395 - 712200
Alignment:
| Q |
14 |
caaaggcaaatgcacaaggtactaaagctaagaaggctgtcacaaacaagattgaagtcttcatgnnnnnnnnggaacaattcaatttatgtattttgct |
113 |
Q |
| |
|
|||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
712395 |
caaaggcaaaggcacaagatgctaaagctaagaaggctgtcacaaacaagattgaagtcttcatgttttttt-ggaacaattcaatttatgtattttgct |
712297 |
T |
 |
| Q |
114 |
tgtatatggttggttatgcaaacatggtgtctttttataagcaagtgtgacattggaatagttttacttgcacaaagcctataaagaccaagtaaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
712296 |
tgtatatggttggttatgcaaacatggtgtctatttataagcaagtgtgacattggaatagttttacttgcacaaagcctataaagaccaagtaaat |
712200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University