View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14102_low_14 (Length: 242)

Name: NF14102_low_14
Description: NF14102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14102_low_14
NF14102_low_14
[»] chr3 (1 HSPs)
chr3 (1-216)||(43710256-43710475)


Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 43710256 - 43710475
Alignment:
1 ttttcaaaaattgaaacttaactactatataagtctagggtggttataccatttaccatatataggagatgccaatgctcaatttaagggttaggactta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43710256 ttttcaaaaattgaaacttaactactatataagtctagggtggttataccatttaccatatataggagatgccaatgctcaatttaagggttaggactta 43710355  T
101 ggaccatctcaattattgagctgtaaaacacgcaataattttatatgacatataatga----gagannnnnnnnnnnnnaatgtaaaacacgcaaccaac 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||             |||||||||||||||||||||    
43710356 ggaccatctcaattattgagctgtaaaacacgcaataattttatatgacatataatgagtatgagaggggggtagggggaatgtaaaacacgcaaccaac 43710455  T
197 cagggcacatgatactgaaa 216  Q
    ||||||||||||||||||||    
43710456 cagggcacatgatactgaaa 43710475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University