View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14102_low_14 (Length: 242)
Name: NF14102_low_14
Description: NF14102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14102_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 43710256 - 43710475
Alignment:
| Q |
1 |
ttttcaaaaattgaaacttaactactatataagtctagggtggttataccatttaccatatataggagatgccaatgctcaatttaagggttaggactta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43710256 |
ttttcaaaaattgaaacttaactactatataagtctagggtggttataccatttaccatatataggagatgccaatgctcaatttaagggttaggactta |
43710355 |
T |
 |
| Q |
101 |
ggaccatctcaattattgagctgtaaaacacgcaataattttatatgacatataatga----gagannnnnnnnnnnnnaatgtaaaacacgcaaccaac |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
43710356 |
ggaccatctcaattattgagctgtaaaacacgcaataattttatatgacatataatgagtatgagaggggggtagggggaatgtaaaacacgcaaccaac |
43710455 |
T |
 |
| Q |
197 |
cagggcacatgatactgaaa |
216 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43710456 |
cagggcacatgatactgaaa |
43710475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University