View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14103_high_3 (Length: 305)
Name: NF14103_high_3
Description: NF14103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14103_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 55 - 162
Target Start/End: Original strand, 1816060 - 1816167
Alignment:
| Q |
55 |
gtttgagacttcgattttgttggtagtagtattagttaataaacttatcctgtaattttcagtcttgtgttgatttgtagggaaaattcatatcactatt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1816060 |
gtttgagacttcgattttgttggtagtagtattagttaataaacttatcctgtaattttcactcttgtgttgatttgtagggaaaattcatatcactatt |
1816159 |
T |
 |
| Q |
155 |
agttcttg |
162 |
Q |
| |
|
|||||||| |
|
|
| T |
1816160 |
agttcttg |
1816167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 221 - 288
Target Start/End: Original strand, 1816226 - 1816293
Alignment:
| Q |
221 |
gtagtacttcatgtttgttcaacgtcaaggttttgctgagtgtatgaagctacctagctcagatattt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1816226 |
gtagtacttcatgtttgttcaacgtcaaggttttgctgaatgtatgaagctacctagctcagatattt |
1816293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University