View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14104_high_8 (Length: 300)
Name: NF14104_high_8
Description: NF14104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14104_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 7 - 290
Target Start/End: Complemental strand, 40903241 - 40902962
Alignment:
| Q |
7 |
gaatcgaatgggtgagtagtaagttgtttgttgctttgcaatgctactagtgctcnnnnnnnnnnnnnnnnnnnntggaactaactacgtgacagtgacc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||||| |
|
|
| T |
40903241 |
gaatcgaatgggtgagtagtaagttgtttgttgctttgcaatgctactagtactcgtgttgtgttgtgtt-----tggaactaactacgtgtcagtgacc |
40903147 |
T |
|
| Q |
107 |
tttataggtgcatagtacttacttgcactagtgggaacagaaaataaacgaatgattttctatttccaaacatagtatagtactttaannnnnnnaaaca |
206 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40903146 |
tttataggtgcatagtactt----gcactagtgggaatagaaaataaacgaatgattttctatttccaaacatagtatagtactttaatttttttaaaca |
40903051 |
T |
|
| Q |
207 |
agaaacattaaaatacataccac-----tttggtttggttttgtgggataccgatgttgctgttgttttatttccaaccggcgcctttg |
290 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40903050 |
agaaacattaaaatacataccactttggtttggtttggttttgtgggataccgctgttgctgttgttttatttccaaccggcgcctttg |
40902962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University