View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14104_low_11 (Length: 260)
Name: NF14104_low_11
Description: NF14104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14104_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 154 - 249
Target Start/End: Complemental strand, 39521307 - 39521212
Alignment:
| Q |
154 |
gatgagtcttttaagaaaacctagttcaaatcttagttaaaacaaatttttaatcggactttacatatcaaataataataatctatacaaatatat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39521307 |
gatgagtcttttaagaaaacctagttcaaatcttagttaaaacaaatttttaattggactttacatatcaaataataataatctatacaaatatat |
39521212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 35 - 88
Target Start/End: Complemental strand, 39521423 - 39521370
Alignment:
| Q |
35 |
tatgacataagagatctaactaaagtaacgtggcagaagcaatgagtatggtgg |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39521423 |
tatgacataagagatctaactaaagtaacgtggcagaagcaatgagtatggtgg |
39521370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University