View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14104_low_12 (Length: 251)
Name: NF14104_low_12
Description: NF14104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14104_low_12 |
 | |
|
| [»] scaffold0019 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0019 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 141995 - 142232
Alignment:
| Q |
1 |
tgttttgataggtgtaggtgaatcatccaaacatttccaaggtatctgaaaagaacccatgagaaatggaggttaattggctaaggcggtggtgcaacgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
141995 |
tgttttgataggtgtaggtgaatcatccaaacatttccaaggtatctgaaaagaacccatgagaaatggaggttaattggctaaggcggtggtgcaacgg |
142094 |
T |
|
| Q |
101 |
tgttttcttttaggttaagcaagaagatggtgaagagtgtaaattctccacagcttctctctcatctctctaaaaccaagaaaattgactctagaggtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
142095 |
tgttttcttttaggttaagcaagaagatggtgaagagtgtaaattctccacagcttctctctcatctctctaaaaccaagaaaattgactctagaggtgt |
142194 |
T |
|
| Q |
201 |
accacaagcagatgttaagctttttcttttcatagcct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
142195 |
accacaagcagatgttaagctttttcttttcatagcct |
142232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 204 - 238
Target Start/End: Original strand, 174329 - 174363
Alignment:
| Q |
204 |
acaagcagatgttaagctttttcttttcatagcct |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
174329 |
acaagcagatgttaagctttttcttttcatagcct |
174363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 204 - 238
Target Start/End: Complemental strand, 13250766 - 13250732
Alignment:
| Q |
204 |
acaagcagatgttaagctttttcttttcatagcct |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13250766 |
acaagcagatgttaagctttttcttttcatagcct |
13250732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University