View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14104_low_13 (Length: 227)
Name: NF14104_low_13
Description: NF14104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14104_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 541415 - 541617
Alignment:
| Q |
13 |
caaaggcaaaaatgaagaagaatacctgaaggaagtgtatagcagtgtcatcgttttggggtctagcggtattgaggaagattgataccaaggtttcttc |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
541415 |
caaaagcaaaaatgaagaagaatacctgaaggaagtgtatagcagtgtcatcgttttggggtctagcggtattgaggaagattgatatcaaggtttcttc |
541514 |
T |
|
| Q |
113 |
tttatcagaaaactccattcaaatcaatatattcgattgatttcggaattagggttttatgcttgttttctgaagaaatcttggagaacaagtatgaaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
541515 |
tttatcagaaaactccattcaaatcaatatattcgattgatttcggaattagggttttatgcttgttttctgaagaaatcttggagaacaagtatgaaaa |
541614 |
T |
|
| Q |
213 |
agg |
215 |
Q |
| |
|
||| |
|
|
| T |
541615 |
agg |
541617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University