View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14104_low_4 (Length: 598)
Name: NF14104_low_4
Description: NF14104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14104_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 445; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 445; E-Value: 0
Query Start/End: Original strand, 1 - 445
Target Start/End: Original strand, 45892856 - 45893300
Alignment:
| Q |
1 |
caggctgttttgacaagaaataatactataactggattggcatataaggatgacccgaccatatttgcatgggagcttatgaatgaacctcgttctcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45892856 |
caggctgttttgacaagaaataatactataactggattggcatataaggatgacccgaccatatttgcatgggagcttatgaatgaacctcgttctcaaa |
45892955 |
T |
|
| Q |
101 |
gtgactcttccggcaaatcatttcaggtttatttccctacatagtttttgtgttattatctacctcttgtcaatagtagttgtctacataaatttactag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45892956 |
gtgactcttccggcaaatcatttcaggtttatttccctacatagtttttgtgttattatctacctcttgtcaatagtagttgtctacataaatttactag |
45893055 |
T |
|
| Q |
201 |
aagttgctaattaactatgtttattacaggattgggtgagtgaaatggctgcttatgtgaagtctattgatagcaaccatttactagaagttggtcttga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45893056 |
aagttgctaattaactatgtttattacaggattgggtgagtgaaatggctgcttatgtgaagtctattgatagcaaccatttactagaagttggtcttga |
45893155 |
T |
|
| Q |
301 |
aggattttacggtgaatcaatgccggaaaagaatcccggatatggagttggaactgatttcatttccaataaccaagttcccgaaattgatttcaccacc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45893156 |
aggattttacggtgaatcaatgccggaaaagaatcccggatatggagttggaactgatttcatttccaataaccaagttcccgaaattgatttcaccacc |
45893255 |
T |
|
| Q |
401 |
attcatctctaccctgaatcatggtaaatcctctacatatagttc |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45893256 |
attcatctctaccctgaatcatggtaaatcctctacatatagttc |
45893300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 510 - 582
Target Start/End: Original strand, 45893362 - 45893438
Alignment:
| Q |
510 |
attgaattattagacnnnnnnngtatcaaaatcgatctctataa----ataataatcgataatgtgaattatggatg |
582 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45893362 |
attgaattattagacaaaaaaagtatcaaaatcaatctctataaataaataataatcgataatgtgaattatggatg |
45893438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 9e-16; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 38142149 - 38142098
Alignment:
| Q |
43 |
tataaggatgacccgaccatatttgcatgggagcttatgaatgaacctcgtt |
94 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38142149 |
tataaggatgacccaaccatttttgcatgggagcttatgaatgaacctcgtt |
38142098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 64 - 94
Target Start/End: Complemental strand, 38155281 - 38155251
Alignment:
| Q |
64 |
tttgcatgggagcttatgaatgaacctcgtt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38155281 |
tttgcatgggagcttatgaatgaacctcgtt |
38155251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 296 - 333
Target Start/End: Complemental strand, 38089755 - 38089718
Alignment:
| Q |
296 |
cttgaaggattttacggtgaatcaatgccggaaaagaa |
333 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
38089755 |
cttgaaggattttatggtgaaacaatgccggaaaagaa |
38089718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 38110603 - 38110510
Alignment:
| Q |
1 |
caggctgttttgacaagaaataatactataactggattggcatataaggatgacccgaccatatttgcatgggagcttatgaatgaacctcgtt |
94 |
Q |
| |
|
|||||||| ||||||||||||| ||||||| ||| || |||||||||||| || ||||| || || ||||||||||| || ||||| |||| |
|
|
| T |
38110603 |
caggctgtgctgacaagaaataacactataaatggggtgttatataaggatgatccaaccattttcgcttgggagcttataaacgaaccacgtt |
38110510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University