View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14105_high_12 (Length: 275)
Name: NF14105_high_12
Description: NF14105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14105_high_12 |
 | |
|
| [»] scaffold0153 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0153 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: scaffold0153
Description:
Target: scaffold0153; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 263
Target Start/End: Complemental strand, 36704 - 36460
Alignment:
| Q |
19 |
gttcttccatcaaaacttcagctttttgcgtcaaaccacaccataacaccccattacgatccttatagagctcaaaaagttttggggttttgcgaagaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36704 |
gttcttccatcaaaacttcagctttttgtgtcaaaccacaccataacaccccattacgatccttatagagctcaaaaagttttggggttttgcgaagaaa |
36605 |
T |
|
| Q |
119 |
atcagagattctgtgaggttttggaaggctgatttgtttacgataatgtgaaagggatcgaacgggaataacaatttctggttcttgttcgagaagttct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36604 |
atcagagattctgtgaggttttggaaggctgatttgtttacgataatgtgaaagggatcgaacgggaataacaatttctggttcttgttcgagaagttct |
36505 |
T |
|
| Q |
219 |
attnnnnnnncgattttggatgttatcttccatttctctgctgct |
263 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
36504 |
attaaaaaaacgattttggatgttatcttccatttctctgttgct |
36460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 263
Target Start/End: Complemental strand, 48661933 - 48661689
Alignment:
| Q |
19 |
gttcttccatcaaaacttcagctttttgcgtcaaaccacaccataacaccccattacgatccttatagagctcaaaaagttttggggttttgcgaagaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48661933 |
gttcttccatcaaaacttcagctttttgagtcaaaccacaccataacaccccattacgatccttatagagctcaaaaagttttggggttttgcgaagaaa |
48661834 |
T |
|
| Q |
119 |
atcagagattctgtgaggttttggaaggctgatttgtttacgataatgtgaaagggatcgaacgggaataacaatttctggttcttgttcgagaagttct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48661833 |
atcagagattctgtgaggttttggaaggctgatttgtttacgataatgtgaaagggatcgaacgggaataacaatttctggttcttgttcgagaagttct |
48661734 |
T |
|
| Q |
219 |
attnnnnnnncgattttggatgttatcttccatttctctgctgct |
263 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
48661733 |
attaaaaaaacgattttggatgttatcttccatttctctgttgct |
48661689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University