View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14105_low_15 (Length: 277)

Name: NF14105_low_15
Description: NF14105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14105_low_15
NF14105_low_15
[»] chr8 (1 HSPs)
chr8 (9-259)||(45303972-45304213)


Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 9 - 259
Target Start/End: Original strand, 45303972 - 45304213
Alignment:
9 agcaaaggtgtgaaggtgagggttgtcttgtttgttttggtggtctctcaatttcatttcatttcatagaaagaagaataatggaatgggggagtgccca 108  Q
    |||||||||||||||||||||||||||    ||||||||||||||||| |     |||||||||||||||||||||||||||||||||||||||||||||    
45303972 agcaaaggtgtgaaggtgagggttgtc----ttgttttggtggtctctaa-----atttcatttcatagaaagaagaataatggaatgggggagtgccca 45304062  T
109 aaagctactgacttgacttgaatgaatatgcacaagccccaaaagcccagctaagtttcataacagcagccccgacagaaaggaagtaatgcagctttta 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
45304063 aaagctactgacttgacttgaatgaatatgcacaagccccaaaagcccagctaagtttcataacagcagccccgacagaaaggaaggaatgcagctttta 45304162  T
209 ggacccttttcatttcccaacaaattactactacaacgaaaccttttcttt 259  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
45304163 ggacccttttcatttcccaacaaattactactacaacgaaaccttttcttt 45304213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University