View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14105_low_15 (Length: 277)
Name: NF14105_low_15
Description: NF14105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14105_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 9 - 259
Target Start/End: Original strand, 45303972 - 45304213
Alignment:
| Q |
9 |
agcaaaggtgtgaaggtgagggttgtcttgtttgttttggtggtctctcaatttcatttcatttcatagaaagaagaataatggaatgggggagtgccca |
108 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45303972 |
agcaaaggtgtgaaggtgagggttgtc----ttgttttggtggtctctaa-----atttcatttcatagaaagaagaataatggaatgggggagtgccca |
45304062 |
T |
 |
| Q |
109 |
aaagctactgacttgacttgaatgaatatgcacaagccccaaaagcccagctaagtttcataacagcagccccgacagaaaggaagtaatgcagctttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45304063 |
aaagctactgacttgacttgaatgaatatgcacaagccccaaaagcccagctaagtttcataacagcagccccgacagaaaggaaggaatgcagctttta |
45304162 |
T |
 |
| Q |
209 |
ggacccttttcatttcccaacaaattactactacaacgaaaccttttcttt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45304163 |
ggacccttttcatttcccaacaaattactactacaacgaaaccttttcttt |
45304213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University