View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14105_low_17 (Length: 274)

Name: NF14105_low_17
Description: NF14105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14105_low_17
NF14105_low_17
[»] chr2 (8 HSPs)
chr2 (15-241)||(8978959-8979187)
chr2 (15-201)||(8973836-8974021)
chr2 (102-201)||(8995549-8995648)
chr2 (102-201)||(9015963-9016062)
chr2 (15-88)||(8995436-8995509)
chr2 (15-91)||(8984322-8984399)
chr2 (113-201)||(9019988-9020076)
chr2 (197-241)||(8972980-8973024)
[»] chr1 (1 HSPs)
chr1 (15-91)||(14686177-14686252)


Alignment Details
Target: chr2 (Bit Score: 162; Significance: 2e-86; HSPs: 8)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 15 - 241
Target Start/End: Original strand, 8978959 - 8979187
Alignment:
15 agttttcactttccctttgaaacctcaaatatctaggtgcatatgtctgtactataatctgaaaattatgcattattgatcagct--ttatcttcaattc 112  Q
    ||||||||||||| |||||||| || |||| |||||||||||||| ||||||||||||||||||||||||||||||| |  | ||  ||||||| |||||    
8978959 agttttcactttcactttgaaagctgaaatttctaggtgcatatgcctgtactataatctgaaaattatgcattattaagaacctgtttatctttaattc 8979058  T
113 ttcaactttagttttacctatccattaatggccattaccattgccgctcaactgttatttaatgtctacatatgatgttgcagacttgattttttcgaga 212  Q
    ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
8979059 ttcaactttagttttacctatgcattaatggccattaccattgccactcaactgttatttaatgtctgcatatgatgttgcagacttgattttttcgaga 8979158  T
213 actggtgcaagtgcaatgacttgttatga 241  Q
    |||||||||| ||||||||||||||||||    
8979159 actggtgcaaatgcaatgacttgttatga 8979187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 15 - 201
Target Start/End: Original strand, 8973836 - 8974021
Alignment:
15 agttttcactttccctttgaaacctcaaatatctaggtgcatatgtctgtactataatctgaaaattatgcattattgatcagct--ttatcttcaattc 112  Q
    ||||||||||||| || ||||||||| ||| ||||||||||||||||||| |||||   |||||||||||||||||| |    ||  |||||||||| ||    
8973836 agttttcactttcactctgaaacctcgaatttctaggtgcatatgtctgtcctata---tgaaaattatgcattattaagagcctggttatcttcaactc 8973932  T
113 ttcaactttagttttacctatccattaatggccattaccattgccgctcaactgttatttaatgtctacatatgatgttgcagacttga 201  Q
    ||||||||||||||||||| | |||||||||||  ||||||| || ||| || ||| | ||||||||  |||||||| |||||||||||    
8973933 ttcaactttagttttacctttgcattaatggccgctaccattaccactccaccgttttctaatgtctgtatatgatgctgcagacttga 8974021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 102 - 201
Target Start/End: Original strand, 8995549 - 8995648
Alignment:
102 atcttcaattcttcaactttagttttacctatccattaatggccattaccattgccgctcaactgttatttaatgtctacatatgatgttgcagacttga 201  Q
    ||||||||||||||||||||||||||| |||| |||||||||||| ||||||  || |||||| ||| | |||| ||   |||||||| |||||||||||    
8995549 atcttcaattcttcaactttagttttatctatgcattaatggccactaccatcaccactcaaccgttttctaatttcagtatatgatgctgcagacttga 8995648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 102 - 201
Target Start/End: Original strand, 9015963 - 9016062
Alignment:
102 atcttcaattcttcaactttagttttacctatccattaatggccattaccattgccgctcaactgttatttaatgtctacatatgatgttgcagacttga 201  Q
    |||| |||||||||||||||||| |||||||| ||| |||||||  ||||||| || ||| || ||| | |||| ||||||||||||| |||||||||||    
9015963 atctacaattcttcaactttagtcttacctatgcatgaatggccgataccattaccactccaccgttttctaatatctacatatgatgctgcagacttga 9016062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 15 - 88
Target Start/End: Original strand, 8995436 - 8995509
Alignment:
15 agttttcactttccctttgaaacctcaaatatctaggtgcatatgtctgtactataatctgaaaattatgcatt 88  Q
    ||||||| ||||| |||||||||||||||| || | |||||||||||||||||||||  || ||||||||||||    
8995436 agttttccctttcactttgaaacctcaaatttccatgtgcatatgtctgtactataacatgcaaattatgcatt 8995509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 15 - 91
Target Start/End: Original strand, 8984322 - 8984399
Alignment:
15 agttttcactttccctttgaaacctcaaatatctaggtgcat-atgtctgtactataatctgaaaattatgcattatt 91  Q
    |||||||||| || |||||||||||||||| || | |||||| |||||||||| ||||| || |||||||||||||||    
8984322 agttttcactatcactttgaaacctcaaatttccatgtgcattatgtctgtacaataatatgcaaattatgcattatt 8984399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 113 - 201
Target Start/End: Original strand, 9019988 - 9020076
Alignment:
113 ttcaactttagttttacctatccattaatggccattaccattgccgctcaactgttatttaatgtctacatatgatgttgcagacttga 201  Q
    ||||||||||||||||||| | |||||||||||  ||||||| || ||| || ||| | |||||||| ||||||||| |||| ||||||    
9019988 ttcaactttagttttacctttgcattaatggccgctaccattaccactccaccgttttctaatgtctgcatatgatgctgcatacttga 9020076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 197 - 241
Target Start/End: Original strand, 8972980 - 8973024
Alignment:
197 cttgattttttcgagaactggtgcaagtgcaatgacttgttatga 241  Q
    ||||||| |||| |||| ||||||||||||| |||||||||||||    
8972980 cttgattgtttctagaaatggtgcaagtgcagtgacttgttatga 8973024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 15 - 91
Target Start/End: Original strand, 14686177 - 14686252
Alignment:
15 agttttcactttccctttgaaacctcaaatatctaggtgcatatgtctgtactataatctgaaaattatgcattatt 91  Q
    ||||||||||||| |||||||||||||||| |||| |||||||||||| |||| |||| || ||  |||||||||||    
14686177 agttttcactttcactttgaaacctcaaat-tctatgtgcatatgtctctactctaatatgcaagctatgcattatt 14686252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University