View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14105_low_7 (Length: 365)
Name: NF14105_low_7
Description: NF14105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14105_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 18 - 349
Target Start/End: Complemental strand, 37717701 - 37717370
Alignment:
| Q |
18 |
actcgacctctaattcattgcacaagtatagagacataaccatcaaacaacgatcttttaattacgataaatcaaggttattaatgaattctactgggga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37717701 |
actcgacctctaattcattgcacaagtatagagacataaccatcaaacaacgatcttttaattacgataaatcaaggttattaatgaattctactgggga |
37717602 |
T |
|
| Q |
118 |
tatacaattttggaggtggtatgacattcaatggatgaacgagtggtcgcggccatcagacgtatgtgacagacataattattgtggtagctttagcagc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37717601 |
tatacaattttggaggtggtatgacattcaatggatgaacgagtggtcgcggccatcagacgtatgtgacagacataattattgtggtagctttagcagc |
37717502 |
T |
|
| Q |
218 |
tgcaacaaaaataattggataccgtgtaagtgtttgccaggatttcgtcgcaggttgtcggataatgatcatggttaccttggagaacgctatcaaggat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37717501 |
tgcaacaaaaataattggataccgtgtaagtgtttgccaggatttcgtcgcaggttgtcggataatgatcatggttaccttggagaacgctaccaaggat |
37717402 |
T |
|
| Q |
318 |
gtgttagaaaatcatccaaacagtgtgtcaca |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37717401 |
gtgttagaaaatcatccaaacagtgtgtcaca |
37717370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University