View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14106_low_5 (Length: 294)
Name: NF14106_low_5
Description: NF14106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14106_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 282
Target Start/End: Original strand, 31912285 - 31912551
Alignment:
| Q |
16 |
tgaacgctcctttagatgttgtcattaaattatttcaaatccaaacaaagcttaatgagaaacataaggagcagaaatatgaaattttgaccaaaaggt- |
114 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
31912285 |
tgaacgctcctttagatgttgtcactaaattatatcaaatccaaacaaagcttaatgagaaacataaggagtagaaggatgaaattttgaccaaaaggtg |
31912384 |
T |
|
| Q |
115 |
ggctttcattgcgtctgaaaaaccaaattatcttgagcgaaataaaattatcaatcaaattccttgtttctggtcaactattttttcaaacaatgatgaa |
214 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| ||| ||||||||||| ||||| ||| |||||||| |
|
|
| T |
31912385 |
ggctttcattgcgtctgaaaaactaaattatcttgagctaaataaaattatcaatcaaattcctgatttttggtcaactatgttttcgaac-atgatgaa |
31912483 |
T |
|
| Q |
215 |
cttgataattgcttcaccaatgaagataaagagattttgaaacacttggcttctcttgaggttgaagg |
282 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31912484 |
cttggtaattgcttcaccaatgaagataaagagattttcaaacacttggcttctcttgaggttgaagg |
31912551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University