View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14107_high_24 (Length: 288)
Name: NF14107_high_24
Description: NF14107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14107_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 12 - 245
Target Start/End: Original strand, 44554998 - 44555227
Alignment:
| Q |
12 |
tctatcttaattaattatcttatatatgtgagtgaccttaaaatagcaaattaataatgtaagaaatggctgacaaagaaaattcactttaaaaaacata |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44554998 |
tctatcttaattaattatcttatatatgtgagtgaccttaacatagcaaattaataatgtaagaaatggctgacaaagaaaattcactttaaaaaacata |
44555097 |
T |
 |
| Q |
112 |
tagtggcaaaaagaccacacacnnnnnnnnnnnnnatacacatacttaacttgatatataattcattacttttgctaaggaatcttagtaggtatctcaa |
211 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44555098 |
tagtggcaaaaagaccacacac----atatatataatacacatacttaacttgatatataattcattacttttgctaaggaatcttagtagatatctcaa |
44555193 |
T |
 |
| Q |
212 |
gatactaggcattgacaagtagaaaacataagtt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44555194 |
gatactaggcattgacaagtagaaaacataagtt |
44555227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 288
Target Start/End: Original strand, 44555236 - 44555265
Alignment:
| Q |
259 |
gagttcctcatgaatcatgacattgatatt |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44555236 |
gagttcctcatgaatcatgacattgatatt |
44555265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University