View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14107_high_35 (Length: 224)
Name: NF14107_high_35
Description: NF14107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14107_high_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 207
Target Start/End: Complemental strand, 26391679 - 26391491
Alignment:
| Q |
17 |
atgagcatatatgaattattacatacacgtggcaggaaacctaaatttgacttttcatacacactattattatatgctgtgctgtcccattattgttttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26391679 |
atgagcatatatgaattattacatacacgtggcagggaacctaaatttgacttttcatacac--tattattatatgctgcgctgtcccattattgttttt |
26391582 |
T |
 |
| Q |
117 |
cacatcataaaacagagcaaagagtgtctgaaagtgagtgagacaataattcacaatgtctacattgagcgtccctcatcctcttccccct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26391581 |
cacatcataaaacagagcaaagagtgtctgaaagtgagtgagacaataattcacaatgtcgacattgagcgtccctcatcctcttccccct |
26391491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University