View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14107_high_41 (Length: 203)
Name: NF14107_high_41
Description: NF14107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14107_high_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 22719024 - 22718840
Alignment:
| Q |
1 |
caacatagtctatttcatctttgaagttatataaagaaccatgtatttattttacctgaagcaatgtatgacaaccaatcagttgattcaccttatgaac |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22719024 |
caacatagtctatttcatctttaaagttatataaagaaccatgtatttattttacctgaagcaatgtatgacaaccaatcagttgattcaccttatgaac |
22718925 |
T |
 |
| Q |
101 |
aggggcaacattaaactcataaaccatctccaaatcacgaaaatactataaataggtctcatcaacatagtatcgtaggtacacc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22718924 |
aggggcaacattaaactcataaaccatctccaaatcacgaaaatactataaataggtctcatcaacatagtatcgtaggtacacc |
22718840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University