View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14107_low_27 (Length: 284)
Name: NF14107_low_27
Description: NF14107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14107_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 19 - 119
Target Start/End: Complemental strand, 2624081 - 2623980
Alignment:
| Q |
19 |
aacaagactattttctctgaggactcgtgatatgtcagagaggaaaccaacac-gttgtctgcactcaactctagtttaacactctgcatgttagaaaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2624081 |
aacaagactattttctctgaggactcgtgatatgtcagagaggaaaccaacactgttgtctgcactcaactctagtttaacactctgcatgttagaaaca |
2623982 |
T |
|
| Q |
118 |
ag |
119 |
Q |
| |
|
|| |
|
|
| T |
2623981 |
ag |
2623980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 159 - 273
Target Start/End: Complemental strand, 2623941 - 2623825
Alignment:
| Q |
159 |
gaccaatttaatggttagaaactgtttgaaattttcaagggagcctgcggatcattaccttggac--cnnnnnnnncaatcatacatgtgagttaggatg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
2623941 |
gaccaatttaatggttagaaactgtttgaaattttcaagggagcctgccgattattaccttggacaaaaaaaaaaaaaatcatacaagtgagttaggatg |
2623842 |
T |
|
| Q |
257 |
tcacatcttcacccata |
273 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
2623841 |
tcacatcttcacccata |
2623825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University