View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14107_low_31 (Length: 274)
Name: NF14107_low_31
Description: NF14107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14107_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 41706900 - 41707152
Alignment:
| Q |
1 |
tttttattgtttgaatgaggatgttgtcactgttaagatgatgacatgagaaaatctagccccaatatttttcagttgtgtggaatgaaccaggtacaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41706900 |
tttttattgtttgaatgaggatgttgtcactgttaagatgatgacatgagaaaatctagccccaatatttttcagttgtgtggaatgaaccaggtacaca |
41706999 |
T |
|
| Q |
101 |
atccaaggtatggaatgaaattccaagatgatgagttaaattctcttaactcactttgagccatgcctagggagttggggataagggggaccattgctat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41707000 |
atccaaggtatggaatgaaattccaagatgatgagttaaattctcttaactcagtttgagccatgcctagggagttggggata--ggggaccattgctat |
41707097 |
T |
|
| Q |
201 |
tgtatgattttggacagaactaaaagattctttgctgttttagttcatgtagtac |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41707098 |
tgtatgattttggacagaactaaaagattctttgctgttttagttcatgtagtac |
41707152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University