View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14107_low_34 (Length: 259)
Name: NF14107_low_34
Description: NF14107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14107_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 5729488 - 5729255
Alignment:
| Q |
1 |
ccaagataatcatatcacaattggtcaaaaaagatgatggtgatagtcatatcagttcacatcagtaataataagtgatatatactgtataatttgtcga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5729488 |
ccaagataatcatatcacaattggtcaaaaaagatgatggtgatagtcatatcagttcacatcagtaataataagtgatatatactgtataatctgtcga |
5729389 |
T |
 |
| Q |
101 |
aaaataaagtactatagtgtataaatcatttttctattgtgatttattattagcgtgaggaaaaatattgtnnnnnnnta-ttatcagagttttgtttgt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| | |||||||||||||| ||| |
|
|
| T |
5729388 |
aaaataaagtactatagtgtataaatcatttttctattgtgatttattatcagcgtgtggaaaaatattgtaaaaaaaaagttatcagagttttgattga |
5729289 |
T |
 |
| Q |
200 |
tttcattgtggttgatcaatgtcaccaatattac |
233 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
5729288 |
tttcattgtagttgatcaatgtcaccaatattac |
5729255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 81 - 123
Target Start/End: Complemental strand, 5696583 - 5696541
Alignment:
| Q |
81 |
tatactgtataatttgtcgaaaaataaagtactatagtgtata |
123 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
5696583 |
tatactgtataatctgtcaaaaaataaagtaccatagtgtata |
5696541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University