View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14107_low_36 (Length: 238)
Name: NF14107_low_36
Description: NF14107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14107_low_36 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 50528898 - 50528670
Alignment:
| Q |
18 |
tgcttttcttggtatgttccaatgtgcttgcttcctcttaattatataaggtttttcatgtctaagtaagta----tatgttttttgattgctgtgtttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50528898 |
tgcttttcttggtatgttccaatgtgcttgcttcctcttaattatataaggtttttcatgtctaagtaagtaagtatatgttttttgattgctgtgtttt |
50528799 |
T |
|
| Q |
114 |
taattccttggcaacgtgtgtggatgg----tgtgatgtgaatattgtctgggattagtgttttctgaatggtattcacaatctttcacaaaggaaaggg |
209 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
50528798 |
taattccttggcaacgtgtgtggatggatggtgtgatgtgaatattgtctgggattagtgttttctgaatggtattcacaatctttcacaaaggaaaagg |
50528699 |
T |
|
| Q |
210 |
acccacttcaacaatatagcctctggctg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
50528698 |
acccacttcaacaatatagcctctggctg |
50528670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University