View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14107_low_39 (Length: 223)
Name: NF14107_low_39
Description: NF14107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14107_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 7948588 - 7948382
Alignment:
| Q |
1 |
tcaaagcaaccacagcctgcaatccaacctcgacaacattatcttcgggaacaagataaacaaacaaaggacctaaaagaagcaaaacaaagctgagtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7948588 |
tcaaagcaaccacagcctgcaatccaacctcgacaacattatcttcgggaacaagataaacaaacaaaggacctaaaagaagcaaaacaaagctgagtgt |
7948489 |
T |
 |
| Q |
101 |
gaagagtgatcctggagttgatggatcagtagcagctgataagacaccaagttcttctgcttttgaaaggagaccaagtttctctattgttgagagagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7948488 |
gaagagtgatcctggagttgatggatcagtagcagctgataaaacaccaagttcttctgcttttgaaaggagaccaagtttctctattgttgagagagat |
7948389 |
T |
 |
| Q |
201 |
aatcctg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
7948388 |
aatcctg |
7948382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University