View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14107_low_40 (Length: 223)
Name: NF14107_low_40
Description: NF14107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14107_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 12 - 205
Target Start/End: Original strand, 24185442 - 24185635
Alignment:
| Q |
12 |
aagaatataggcacaaacaatgttatatctaaccatgcaggataatgttgtcaatgtaaattataaaggaagaattttctatgttttacataatcatttt |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24185442 |
aagaaaataggcacaaacaatgttatatctaaccatgcaggataatgttgtcaatgtaaattataaaggaagaattttctatgttttacataatcatttt |
24185541 |
T |
 |
| Q |
112 |
ctaacatcactagtgctatttcgtgcaaatgcatagaaaaatagtattctgatatcaagttcctgttttgacatatagcaggagaagccgcatc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24185542 |
ctaacatcactagtgctatttcgtgcaaatgcatagaaaaatagtattctgatatcaagttcctgttttgacatatagcaggagaagctgcatc |
24185635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University