View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14108_high_6 (Length: 337)
Name: NF14108_high_6
Description: NF14108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14108_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 19 - 326
Target Start/End: Original strand, 6010669 - 6010976
Alignment:
| Q |
19 |
cttatggtgcctgaaaatgaaagagagtccaaggtacttgaagctaagtcacttcctaatgtgaaactaacaaaagttgattatgaatgggtgcatgtga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6010669 |
cttatggtgcctgaaaatgaaagagagtccaaggtacttgaagctaagtcacttcctaatgtgaaactaacaaaagttgattatgaatgggtgcatgtaa |
6010768 |
T |
 |
| Q |
119 |
ttggtgaaggttgggctagtcctttgaaaggtttcatgagggaaaatgaatatcttcaaagtttgcattttaattcacttaggttgaatgatggttcttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6010769 |
ttggtgaaggttgggctagtcctttgaaaggtttcatgagggaaaatgaatatcttcaaagtttgcattttaattcacttaggttgaatgatggttcttt |
6010868 |
T |
 |
| Q |
219 |
tgttaatatgtcacttcctattgttttgtctattgatgatgagactaaagagagaattggatcttcttctaatgttgggttgattggacctgatggggat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6010869 |
tgttaatatgtcacttcctattgttttgtctattgatgatgagactaaagagagaattggatcttcttctaatgttgggttgattggacctgatggggat |
6010968 |
T |
 |
| Q |
319 |
attcttgg |
326 |
Q |
| |
|
||| |||| |
|
|
| T |
6010969 |
attgttgg |
6010976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 184 - 260
Target Start/End: Complemental strand, 46333245 - 46333169
Alignment:
| Q |
184 |
cattttaattcacttaggttgaatgatggttcttttgttaatatgtcacttcctattgttttgtctattgatgatga |
260 |
Q |
| |
|
||||| ||||||||||| | |||||||| |||||||| |||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
46333245 |
catttcaattcacttagactcaatgatgggtcttttgtgaatatgtctgttcctattgttttggctattgatgatga |
46333169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University