View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14108_low_11 (Length: 205)
Name: NF14108_low_11
Description: NF14108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14108_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 33456717 - 33456532
Alignment:
| Q |
18 |
gaattgaccccttccaacactacaaaactcttccaacaattcttgagcagctttaacatattttgaattcctcaacacattaacaacacctaaagaagaa |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33456717 |
gaattgaccccttccaacactgcaaaactcttccaacaattcttgagcagctttaacatattttgaattcctcaacacattaacaacacctaaagaagaa |
33456618 |
T |
 |
| Q |
118 |
g------aagatgaaccaaatccaacatgtccttgatgaatatgattaatctgtcctaatccacctccttgtaaatgatgatgatg |
197 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33456617 |
gaagaagaagatgaaccaaatccaacatgtccttgatgaatatgattaatctgtcctaatccacctccttgtaaatgatgatgatg |
33456532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 22 - 86
Target Start/End: Original strand, 7066304 - 7066368
Alignment:
| Q |
22 |
tgaccccttccaacactacaaaactcttccaacaattcttgagcagctttaacatattttgaatt |
86 |
Q |
| |
|
||||||||||||||||| |||||||||| | ||||||||||| || ||| | |||||||||||| |
|
|
| T |
7066304 |
tgaccccttccaacactgcaaaactcttgaagcaattcttgagtaggtttcatatattttgaatt |
7066368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University