View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14109_high_17 (Length: 276)
Name: NF14109_high_17
Description: NF14109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14109_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 43532975 - 43533236
Alignment:
| Q |
1 |
aattagctccacagcttcacagggaaaaattctagctgaaaccatgcaggtttttggacttgattgaattatacgtaacagtttgtcaaggctaaaaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43532975 |
aattagctccacagcttcacagggaaaaattctagctgaaaccatgcaggtttttggacttgattgaattatacgtaacagtttgtcaaggctaaaaagg |
43533074 |
T |
|
| Q |
101 |
aacactcctgggaagaccatatagaagtgcttatccccggcatgaaacaagaaaaatactagaaagactatatacaaatgatgtgtgtagtagaaaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43533075 |
aacactcctgggaagaccatatagaagtgcttatccccagcatgaaacaagaaaaatactagaaagactatatacaaatgatgtgtgtagtagaaaattt |
43533174 |
T |
|
| Q |
201 |
caaactttcttcttctaatttggggaagtgaggtaacgaagataacaaggccggcaacaagt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43533175 |
caaactttcttcttctaatttggggaagtgaggtaacgaagataacaaggccggcaacaagt |
43533236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University