View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14109_high_22 (Length: 239)
Name: NF14109_high_22
Description: NF14109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14109_high_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 31576011 - 31576202
Alignment:
| Q |
1 |
tcgccttttattaaagtgtctatttaatttatagagtaccaatatagcttaataatttattttaagagacataaataaggtttttcacatctctcgttga |
100 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
31576011 |
tcgccttttatttaagtgtctgtttaatttatagggtatcaatatagcttaatagtttattttaagagacataaataagatttttcacatctctcgctga |
31576110 |
T |
|
| Q |
101 |
ctctatatgtattcccccggataagttaggaggaggcttattatgctcgagtgcttaggttgcaccttcaacttgaagttattcgctctcccaa |
194 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||| || ||||| ||||||| |
|
|
| T |
31576111 |
ctctatatgtattcccccggataag--aggagaaggcttattatgctcgagtgcttaggttgcaccttgaacttgaaattcttcgccctcccaa |
31576202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University