View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14109_low_26 (Length: 235)
Name: NF14109_low_26
Description: NF14109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14109_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 46738903 - 46738717
Alignment:
| Q |
18 |
atgaaaatgaaaaagaggaggtatatggatttaccaaaacagacaccatttgcacttaataatcagatacagattaatttttctactaaaactttctttt |
117 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46738903 |
atgaagatgaaaaagatgaggtatatggatttaccaaaacagacatcatttgcacttaataatcagattcagattaatttttctactaaaactttctttt |
46738804 |
T |
 |
| Q |
118 |
taagggattttctgctaaaacttgtttcccaagcatttgtgtaattaattctacgataagtctttaaacaatccaccgaaaaatgaa |
204 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46738803 |
taagggattttctactaaaacttgtttcccaagcatttgtgtaattaattctacgataagtctttaaacaatccaccgaaaaatgaa |
46738717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University