View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1410_low_3 (Length: 345)
Name: NF1410_low_3
Description: NF1410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1410_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 103 - 326
Target Start/End: Original strand, 3157484 - 3157704
Alignment:
| Q |
103 |
aacacatgtaattgaatttttcactcacattagttatgacttagatttttctccctgtgataatctagacctactttttattgtaaatattcttccttca |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3157484 |
aacacatgtaattgaatttttcactcacattagttatgacttagatttttctccctctgataatctagacctactttttattgtaaa---tcttccttca |
3157580 |
T |
|
| Q |
203 |
cacgttgatgattcttctagaatttagagaggacatatacttgttcaaaaataaaatataaacannnnnnnnccttatcaaattatgtatggtaagatca |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3157581 |
cacgttgatgattcttctagaatttagagaggacatatacttgttcaaaaataaaatataaacattttttttccttatcaaattatgtatggtaagatca |
3157680 |
T |
|
| Q |
303 |
agtctatagcttgtatcatctttt |
326 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3157681 |
agtctatagcttgtatcatctttt |
3157704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University